Osbpl5^em1(IMPC)J

This allele from project Osbpl5-8180J-F0511 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTCAAACTGCAGAGCCAGG, AGTGAGAGAGTCACACAAAT, GGTGGCCCCGAAGAGTGAGG and TCAGACCTCATCTAAGGCTA, which resulted in a 309 bp deletion beginning at Chromosome 7 negative strand position 143715937 bp, CTCACTCTTCGGGGCCACCT, and ending after GGATCTGGGGTCCTCCTGGC at 143,715,629 bp (GRCm38/mm10). This mutation deletes exon 2 and 152 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 17 and early truncation 75 amino acids later. (J:188991)