This allele from project Prpf40a-8143J-F5722 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATGCGGTCATATTACCACA, AACGTATGGTGGACTTCATT, TTGAAATACATAGCAAGCCT and AGTTTCATGTGTAATCTGTA, which resulted in a 273 bp deletion beginning at Chromosome 2 negative strand position 53,176,555 bp, CTAGGAGTTGAAACCTCTAGA, and ending after AGAGATTGTTCAACAGAAGC at 53,176,283 bp (GRCm38/mm10). This mutation deletes exon 4 and 242 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 126 and early truncation 102 amino acids later. (J:188991)