This allele from project Mccc2-8043J-M4937 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGGTACAGAAGACACGCTG, ATTTAGAAGCATTTGTTGAT, GTAAAGTGCCGTGTTTGGCG and ACAATGCTCCACGCCAAACA, which resulted in a 511 bp deletion beginning at Chromosome 13 positive strand position 99,993,340 bp, CATGCTGGATGCTGCCATGC, and ending after GCAGATCTCTCAGTTTGGAG at 99,993,850 bp (GRCm38/mm10). This mutation deletes exon 3 and 426 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 66 and early truncation 34 amino acids later. (J:188991)