This allele from project Gpx6-8181J-F8998 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTACCATCTATGGGCACCC, GGTTTACCAACTATCGAGTG, ACACATCTTGGGGAAAGCCT and AGATAGTTGTGGCATTAATG, which resulted in a 576 bp deletion beginning at Chromosome 13 positive strand position 21,313,423 bp CGAGTGAGGTCACAGCTCCC, and ending after TCCATGCTTGAGCTCCAAGG at 21,313,998 bp (GRCm38/mm10). This mutation deletes exon 2 and 422 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 29 and early truncation 1 amino acid later. (J:188991)