Fars2^em1(IMPC)J

This allele from project Fars2-8206J-F5419 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAGAGTCCCTCTACCCT, CTCTGAGCTACCCAGGGTAG, CATTGTGTAACAGATCACTG and CTAAGAAATAGGGAACGGGG, which resulted in a 467 bp deletion beginning at Chromosome 13 positive strand position 36,231,888 bp CCTGGGTAGCTCAGAGCTTG, and ending after AACATTGTGTAACAGATCAC at 36,232,354 bp (GRCm38/mm10). This mutation deletes exon 3 and 307 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 204 and early truncation 35 amino acids later. (J:188991)