Sdr42e1^em1(IMPC)J

This allele from project Sdr42e1-7839J-F8886 was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences TAGGCCACTGGTCGAGGGCC and GTCGCCTCTTACGGCATGTC, which resulted in a 604 bp deletion beginning at Chromosome 8 negative strand position 117,663,658 bp CTCTTACGGCATGTCTGGGA and ending after ACACATTCCCATCCACCCGC at 117,663,055 bp (GRCm38/mm10). This mutation deletes 604 bp of exon 3 and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 2 amino acids later. (J:188991)