This allele from project Clptm1l-8201J-M4248 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCAAGCTCACCCTCTGAG, GTTTCCTAACGGGACCCCAG, ACTGCAATCTAAGGGCAGCG and ATAGCATTGTATGTAGAGTG, which resulted in a 377 bp deletion beginning at Chromosome 13 positive strand position 73,604,838 bp GAGAGGTAGCCCTCAGATTG, and ending after ATCTAAGGGCAGCGTGGTTT at 73,605,214 bp (GRCm38/mm10). This mutation deletes exon 2 and 441 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 54 and early truncation 2 amino acids later. (J:188991)