This allele from project Agfg2-8101J-F2486 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCCCAAAAGAAACTTTTGGG, CTCAAAGCTTTGCTACCAAG, GCTGTGGCAGGTGAGTGCAC and CACAGAAGATGGTCTCAGTC, which resulted in a 562 bp deletion beginning at Chromosome 5 negative strand position 137,668,182 bp, GCAGGGCTCTACCACTGAGC, and ending after CATGCCACTTGGTAGCAAAG at 137,667,621 bp (GRCm38/mm10). This mutation deletes exon 2 and 468 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 14 amino acids later. (J:188991)