This allele from project Ankrd45-8103J-F3985 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGGTTGGGAAGATGTGTGTA, ATGCAGGGACTTGGGTTTTT, GAGTTATCCACTCATAAAGA and TTCTGCCCGGAATTATAGGT, which resulted in a 697 bp deletion beginning at Chromosome 1 positive strand position 161,150,840 bp, CCAAGTCCCTGCATCCCACA and ending after GTTGGTTATAATGTTAGAAA at 161,151,536 bp (GRCm38/mm10). This mutation deletes exon 2 and 344 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a single bp del (A) 23 bp before the 697 bp deletion that will not effect the result of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 25 and early truncation 24 amino acids later. (J:188991)