This allele from project Acy3-8100J-M3948 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGAAGTGAGACATACATG, GCTAACTTCTCACCTTTGGT, GTTTCCCCTCAAGAAGGCCT and GCCCTCCTTCCTGCCCCCTA, which resulted in a 437 bp deletion beginning at Chromosome 19 positive strand position 3,987,498 bp, ATGGGGAACAGGACCAACAT, and ending after TACCTACAGGTGGTCCCTAG at 3,987,934 bp (GRCm38/mm10). This mutation deletes exon 2 and 244 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 63 bp deletion 154 bp downstream of the 437 bp deletion. Overall this mutation is predicted to cause a change of amino acid sequence after residue 79 and early truncation 110 amino acids later. (J:188991)