Ankrd35^em1(IMPC)J

This allele from project Ankrd35-8102J-M2490 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATAGACCTAAAGGTGCTTAG, GGATAATTCTTGATGACACA, GAAGTTCGAACCACATACCA and AGTCAGTGTGGCTTGTGCGG, which resulted in a 383 bp deletion beginning at Chromosome 3 positive strand position 96,677,914 bp TGACACATGGAGTGGTTAGT, and ending after TTTGACCCCACCCTGGTATG at 96,678,296 bp (GRCm38/mm10). This mutation deletes exon 2 and 252 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 20 amino acids later. (J:188991)