This allele from project Dnajb2-8031J-M7944 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATATCCCTGGCACACCACA, GGTGTTGGACTAAGCAAAAA, GAAGGAGTACCAAGAATGAA and CATGTTATGTCTGTCTAGCA, which resulted in a 319 bp deletion beginning at Chromosome 1 positive strand position 75,237,297 bp GGCACACCACAGGGAGAGAA, and ending after GTCCCCCTGCTTCCATTCAT at 75,237,615 bp (GRCm38/mm10). This mutation deletes exon 3 and 209 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 22 and early truncation 6 amino acids later. (J:188991)