This allele from project D930015E06Rik-8030J-M9888 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGAGCCTGAACACCTGGCAA, AGCGCTCCTGTGCCATTGGG, TTTGCCGTGCATTACAAACG and GCCACCCGAGGGGTGAGCCG, which resulted in a 247 bp deletion beginning at Chromosome 3 negative strand position 84,039,415 bp ACGCGGTGTGTTTTTTTGGT and ending after CGAGCCTGAACACCTGGCAA at 84,039,169 bp (GRCm38/mm10). This mutation deletes exon 2 and 176 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 41 and early truncation 1 amino acid later. (J:188991)