Ctbs^em1(IMPC)J

This allele from project Ctbs-8029J-M7923 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTCTAATCTGCTTTCCAAG, CATTATGCTCTCTTTGGGAG, TTACTGTTATTTAAGGTCCT and ACATCTTAGTTTTATAGCAA, which resulted in a 517 bp deletion beginning at Chromosome 3 positive strand position 146,454,800 bp, CTTGGAAAGCAGATTAGAGG, and ending after TGTTACTGTTATTTAAGGTC at 146,455,316 bp (GRCm38/mm10). This mutation deletes exon 3 and 308 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 2 amino acids later. (J:188991)