This allele from project Adamts14-8000J-M9624 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTGGCTTCACATTCCCACT, CTAGGTTATTAGACTAAGAG, AGGGACTGTGAACTGTTGGA and CGAGGGGTGGGGGACATCAG, which resulted in a 269 bp deletion beginning at Chromosome 3 negative strand position 95,685,133 bp GTTGGAAGGGGTCTGGCAAG, and ending after TGGCTTCACATTCCCACTGG at 95,684,865 bp (GRCm38/mm10). This mutation deletes exon 3 and 112 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 58 amino acids later. (J:188991)