This allele from project Rab4b-7935J-M7105 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAGCCTGGGTTCCCAAGGAG, ATGCTGAGACTAGATTCTCC, AGACCATCCACCAAAGCTAG and GAATTGGGGTACAGAAAAGG, which resulted in a 435 bp deletion beginning at Chromosome 7 negative strand position 27,176,049 bp GCTTGCCTCTAGCTTTGGTG, and ending after TCAGCTCCTGGAGAATCTAG at 27,175,615 bp (GRCm38/mm10). This mutation deletes exon 3 and 320 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 2 amino acids later. (J:188991)