This allele from project Cachd1-7843J-M9819 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTAACATATAAACGACACCC, AAACACCTGGACATCATGGT, GCAAGTAATGAGAGATTCAC and ATCTCTATATTTAAACTTGT, which resulted in a 498 bp deletion beginning at Chromosome 4 positive strand position 100,897,481 bp CTACCATGATGTCCAGGTGT, and ending after CTTGTCGGCTTCTGCCCGTG at 100,897,978 bp (GRCm38/mm10). This mutation deletes exon 3 and 349 bp of flanking intronic sequence including the splice acceptor and donor, there is a single bp insertion T at this site, which will not effect the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 101 and early truncation 1 amino acid later. (J:188991)