This allele from project Tbc1d30-7955J-M6512 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGTGTATGTTCTCTGGAAA, ATTGCGTTCCCAGAAGTGTT, TTGGTTTCTGACGCATCAGG and TGGGCATATTAAAATCCTGG, which resulted in a 349 bp deletion beginning at Chromosome 10 negative strand position 121,297,003bp CATCAGGAGGAACTTTGGTC, and ending after CTATTGCGTTCCCAGAAGTG at 121,296,655bp (GRCm38/mm10). This mutation deletes exon 6 and 180 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 199 and early truncation 29 amino acids later. (J:188991)