This allele from project Ncbp1-7919J-M3862 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCTGTTTTAACTAAGCT, TAGCTTAGTTAAAACAGGAT, TTAATTTCTGAAGTTGTCCT and CAATTACAACCCTAACCCCT, which resulted in a 274 bp deletion beginning at Chromosome 4 positive strand position 46,144,660 bp GATTGGTTAAGAACTACTCT, and ending after TTTGATTAATTTCTGAAGTTG at 46,144,933 bp (GRCm38/mm10). This mutation deletes exon 2 and 185 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 18 amino acids later. (J:188991)