This allele from project Kif15-7892J-M7412 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGAGTAGGTCTAGTATT, AGTAACAGGTAAGTTTCCTG, CATTTGAAATATGTAATGTA and CAATTTGTCACTTTTTAGCT, which resulted in a 261 bp deletion beginning at Chromosome 9 positive strand position 122,959,773 bp, GAAACTTACCTGTTACTTTT, and ending after CTTTCATTTGAAATATGTAA at 122,960,033 bp (GRCm38/mm10). This mutation deletes exon 3 and 77 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 20 and early truncation 16 amino acids later. (J:188991)