Foxk2^em1(IMPC)J

This allele from project Foxk2-7879J-M7860 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATACCATGCTTCCTTTAAA, TTTCCTGACCCAGCTCGTTA, TTTATAGTCGTGGATTTGGG and GATACTGGTAACTAGTCCTT, which resulted in a 324 bp deletion beginning at Chromosome 11 positive strand position 121,287,817 bp GGCAAACCACATAATAAATA, and ending after ATACTGGTAACTAGTCCTTT at 121,288,140 bp (GRCm38/mm10). This mutation deletes exon 3 and 176 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 195 and early truncation 12 amino acids later. (J:188991)