This allele from project Dlat-7876J-M7804 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTTTTTATAAAATATGACCC, CAGCTCAGAACTGACACGTG, GACCTTGTCACCCATCACAA and CTGAATGCTTTTATGCGTCC, which resulted in a 325 bp deletion beginning at Chromosome 9 negative strand position 50,653,854 bp, TTGTGATGGGTGACAAGGTC, and ending after TTGCTGCCTGGGTCATATTT at 50,653,530 bp (GRCm38/mm10). This mutation deletes exon 5 and 198 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 7 bp (cgtgtca) intronic deletion 24 bp after the 325 bp deletion that will not alter the result of the mutation. The 325 bp deletion is predicted to cause a change of amino acid sequence after residue 219 and early truncation 30 amino acids later. (J:188991)