This allele from project Drc7-7877J-F7837 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TCTGACTTCTTGCTCTTCCG, GCAAGTCTGGGTCTGGGGTA, GCTCAGCAGAGGAGCCGTAG and GCTCTGAGTACAGAGCTGGC, which resulted in a 292 bp deletion around exon 9 beginning at Chromosome 8 positive strand position 95,070,286 bp, CTCTTCCGGGGAAACTGACA, and ending after TCAACACCCTGCCAGCTCTG at 95,070,577 bp (GRCm38/mm10). This mutation deletes exon 9 and 219 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 404 and early truncation 11 amino acids later. (J:188991)