This allele from project Acy1-7841J-M3824 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GACAAAGTGTCCCCAACCCA, CTGGAGCCTTGAGCAGGGTG, CTGCTTTTGCTGGTACCCAC and TATACATCTCTGGGCTGCCT, which resulted in a 214 bp deletion around exon 3 beginning at Chromosome 9 negative strand position 106,437,075 bp, GAACGCAGATGCAGATGTTT, and ending after TGGAGCCTTGAGCAGGGTGG at 106,436,862 bp (GRCm38/mm10). This mutation deletes exon 3 and 150 bp of flanking intronic sequence including the splice acceptor and donor, in addition there is another 23 bp deletion (ggttggggacactttgtcccctg) in intron 4, 7 bp after the 214 bp deletion, that will not alter the result of the 214 bp deletion. This mutation is predicted to cause a change of amino acid sequence after residue 34 and early truncation 40 amino acids later. (J:188991)