This allele from project Ssx2ip-7709J-F9191 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATACACGTCTATGACAAAA, AGAATCTTTGGTAATGGAGA, TTATGTACCACAAAATGTCG and CATGCAGAGCCACCGAGCCT, which resulted in a 368 bp deletion in exon 4 beginning at Chromosome 3 positive strand position 146,418,140 bp, ATGAACTTGTGCCATTTTGT, and ending after CCACAAAATGTCGAGGCCAC at 146,418,507 bp (GRCm38/mm10). This mutation deletes exon 3 and 198 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 14 and early truncation 11 amino acids later. (J:188991)