This allele from project Prpf4b-7776J-M6407 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATTAGACAACTTTGAGCTT, CTTGTTCACTGCACCAAAAC, CCTGATTACCCAGCACTAGA and GTGTAAGCTCTTCTAGTGAC, which resulted in a 310 bp deletion across exon 5 beginning at Chromosome 13 positive strand position 34,889,350 bp, CTGTTTTGGTGCAGTGAACA, and ending after GTAGTGACAGTAACCAGTCA at 34,889,659 bp (GRCm38/mm10). This mutation deletes exon 5 and 228 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 522 and early truncation 42 amino acids later. (J:188991)