Muc3a^em1(IMPC)J

This allele from project Muc3a-7685J-F6801 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AATCCCCCTTCACCTTTGTG, CGGGTCCACTGACTGCCCCA, CAGAGCCTAGCTTTAGTGAA and TGCGAGGGCGGGCTTTTCCA, which resulted in a 398 bp deletion in exon 3 beginning at Chromosome 5 negative strand position 137,211,645 bp, CGACCTTGGAAAAGCCCGCC, and ending after AGGGTGGAGACGACTGCAAT at 137,211,248 bp (GRCm38/mm10). In addition there is a 2 bp intron insertion tc after the deletion which will not effect the mutation. This mutation deletes exon 3 and 235 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 26 and early truncation 40 amino acids later. (J:188991)