Paf1^em1(IMPC)J

This allele from project Paf1-7694J-M6789 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGAATGCAAGCGTCCAGCAT, TCCTAGAAGCTAAGCTTCTA, GGCCAGCAAAGGCCAGGCCT and CCATGAGGGATACCCAGGCC, which resulted in a 290 bp deletion and 6 bp insertion (ttgcaa) spanning exon 4 beginning at Chromosome 7 positive strand position 28,395,305 bp, CTGGACGCTTGCATTCAGAG, and ending after AGCAAAGGCCAGGCCTGGGT at 28,395,594 bp (GRCm38/mm10). This mutation deletes exon 4 and 168 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 56 and early truncation 6 amino acids later. (J:188991)