Zfp692^em1(IMPC)J

This allele from project Zfp692-7728J-F4807 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGCGAATGGGAGGTCTGTA, TCCGCACTCACACACTTACA, GTCCTCTTCCCGAACCCAGT and TAAAAGACGTTAACAGGTAG, which resulted in a 190 bp deletion spanning exon 3 beginning at Chromosome 11 positive strand position 58307896 bp, GTTGGCCCTGTAAGTGTGTG, and ending after GGATCAGAAGCTCCTACTGG at 58308085 bp (GRCm38/mm10). This mutation deletes exon 3 and 158 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 35 amino acids later. (J:188991)