Rasal1^em1(IMPC)J

This allele from project Rasal1-7697J-M1093 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGGCTAGAGTCTCATATGGT, TGGGGGCATGTGTAGACTCT, GAGAATGGGCTGATTCACAG and TGAACCGAATCACATATCAA, which resulted in a 481 bp deletion spanning exons 4-5 beginning at Chromosome 5 positive strand position 120,654,693 bp, TCTAGGAGTGTGTGTGTGAC, and ending after GAGGGAGAATGGGCTGATTC at 120,655,173 bp (GRCm38/mm10). This mutation deletes exons 4 and 5 and 305 bp of flanking intronic sequence including the splice acceptors and donors. This deletion of exons 4 and 5 is predicted to cause a change of amino acid sequence after residue 41 and early truncation 14 amino acids later. (J:188991)