Zfp560^em1(IMPC)J

This allele from project Zfp560-7726J-F3047 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATGGAACCATGTCAGCCGAA, TTACATCCATTCGGCTGACA, ATTCCCATATAGTCCAACAT and CATGGATGTCACTCTATCCT, which resulted in a 229 bp deletion spanning exon 3 beginning at Chromosome 9 negative strand position 20,352,939 bp, TATGTTGGACTATATGGGAA, and ending after TGTTACATCCATTCGGCTGA at 20,352,711 bp (GRCm38/mm10). This mutation deletes exon 3 and 140 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 4 amino acids later. (J:188991)