This allele from project Klhl2-7678J-M9574 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTGACAACAAAAGTTACCA, GTCTGAATACACCTTCGAAG, TTTGCATAGAACGTTGAGTA and ACGTTGAGTATGGTTATTAT, which resulted in a 205 bp deletion spanning exon 3 beginning at Chromosome 8 negative strand position 64,823,140 bp, TTATTGGAGGCATTTACATT, and ending after CCTGAGACCCTTCCGTGGTA at 64,822,936 bp (GRCm38/mm10). This mutation deletes exon 3 and 98 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 1 amino acids later. (J:188991)