Lamp5^em1(IMPC)J

This allele from project Lamp5-7679J-M9591 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCAGGTGTCCTAAAGCAGA, GGAGCACACTGCTTCGAGCA, CTAGGGGCGGCAGGGCCGAA and ATTCGGGAACAGCCTGCGGG, which resulted in a 405 bp deletion spanning exon 2 beginning at Chromosome 2 positive strand position 136,058,830 bp, CTGCTTCGAGCAGGGAACTT, and ending after CTTCCCCCCCAAACCCCCCG at 136,059,234 bp (GRCm38/mm10). This mutation deletes exon 2 and 232 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 21 and early truncation 6 amino acids later. (J:188991)