Ier2^em1(IMPC)J

This allele from project Ier2-7674J-M6979 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGCAGCAGCGATTTGAGCGA, TGAGCATATTGTCGGCCGGG, ACTGCAACTTCGGCTTCCCG and TACCACTCTCGCATGCAGCG, which resulted in a 404 bp deletion and single base (A) insertion in exon 1 beginning at Chromosome 8 negative strand position 84,662,529 bp, GAAGCCGAAGTTGCAGTGGA, and ending after GCCTGCCGCCCGGCCGACAA at 84,662,126 bp (GRCm38/mm10). This mutation results in a change in amino acid sequence after residue 24 and early truncation 42 amino acids later. (J:188991)