Frmpd1^em1(IMPC)J

This allele from project Frmpd1-7623J-M1181 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGTCAGCCCAAGGATAACAG, ATACACAGAATTTCAAAAGG, GCCCAGCTACTCTCCCTAAG and TGCCTTTTTTACAGGTCAGG, which resulted in a 301 bp deletion spanning exon 3 beginning at Chromosome 4 positive strand position 45243539 bp, CTTTCCTCTGTTATCCTTGGG, and ending after TAGCCTCTTAGGGAGAGTAG at 45243839 bp (GRCm38/mm10). This mutation deletes exon 3 and 143 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 10 amino acids later. (J:188991)