Crebzf^em1(IMPC)J

This allele from project Crebzf-7607J-M4528 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAGAAGCGCTGCATCTCGG, GGTGCCAGTCCGGTTGCCGA, GCCGCGTCGTCCTCTTCCCG and GGTGTCGGTGGAGTTCTGCT, which resulted in a 679 bp deletion in exon 1 beginning at Chromosome 7 positive strand position 90443370 bp, CTCGGCAACCGGACTGGCAC, and ending after AAGGTGTCGGTGGAGTTCTG at 90444048 bp (GRCm38/mm10). This mutation is predicted to cause a change of amino acid sequence after residue 120 and early truncation 15 amino acids later. (J:188991)