Oaz2^em1(IMPC)J

This allele from project Oaz2-7565J-M3140 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGCCCTGAGAATGGCCCAA, TCCTATGCTCCCTAAACCAA, TGGGAATCTGATAAACTGGT and CAAAACATCTACTAACTCAG, which resulted in a 463 bp deletion spanning exon 4 beginning at Chromosome 9 positive strand position 65,687,700 bp, CTGAGAATGGCCCAAGGGAT, and ending after CCACCAGTTTATCAGATTCC at 65688162 bp (GRCm38/mm10). This mutation deletes exon 4 and 287 bp of flanking intronic sequence including the splice acceptor and donor, and is predicted to cause a change of amino acid sequence after residue 59 and early truncation 8 amino acids later. (J:188991)