Zfyve1^em1(IMPC)J

This allele from project Zfyve1-7570J-M3232 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCTGACAAGATGAAGGCGT, ACACTGATGAGTCCCAGGCA, TTACGTTTACAGCGAAAGGG and ATAGTAGTCGTGCCTTACAT, which resulted in a 446 bp deletion spanning exon 4 beginning at Chromosome 12 negative strand position 83,569,169 bp, CTTACATAGGTAGAGTTAAAA, and ending after AGGATGCGCACGGCCTACGC at 83,568,724 bp (GRCm38/mm10). This mutation deletes exon 4 and 231 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to cause an amino acid sequence change after residue 329 and early truncation 3 amino acids later. (J:188991)