This allele from project Adamts14-7576J-M3885 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGAAATCCCAAATCTATAGG, ATGTACAACAGGAGTAAAAG, CTTTACTATGCACTGTGCAG and GATGGGGGGTCATAGGGTGA, which resulted in a 560 bp deletion spanning exon 2 beginning at Chromosome 10 negative strand position 61,271,347 bp, CACCCTATGACCCCCCATCC, and ending after ACCCAGAGCCCCCTATAGATT at 61,270,788 bp (GRCm38/mm10). This mutation deletes exon 2 and 159 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in an amino acid sequence change after residue 27 and early truncation 47 amino acids later. (J:188991)