This allele from project Scgb1c1-7549J-M2473 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTCTGGATCCAGTTAGCCCA, CCTTCCCCATCACCACTAGT, GGAAGAACTGCAAACATTCG, and TGCGAGGTCTCCATCTCTGC, which resulted in a 487 bp deletion spanning exon 2 beginning at Chromosome 7 positive strand position 140,845,938 bp, CCCACTAGTGGTGATGGGG, and ending after ACCCCAAAAGAACTACAT at 140846424 bp (GRCm38/mm10). This mutation deletes exon 2 and 287 bp of flanking intronic sequence including the splice acceptor and donor. There is also a small 9 bp deletion (ttagcccag) 64 bp before the 487 bp deletion that will not affect the results of the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 19 and a stop after an additional 47 amino acids. Note the stop is due to read through into the 3-prime untranslated portion of the transcript. (J:188991)