This allele from project Acot2-7575J-M3846 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CTGGGTGCTTGAAGACCGGA, GGAAACTGTGGACTCAGCCC, CGTTGATGAGGAGATCTGAT, TATAGACTGTCTCCCAGACA, which resulted in a 378 bp deletion spanning exon 2 beginning at Chromosome 12 positive strand position 83,990,413 bp, CTTTATGATCAGTCTGAAAC, and ending after TTGTGGCAGCCCCTCCCTGT at 83,990,790 bp (GRCm38/mm10). This mutation deletes exon 2 and 175 bp of flanking intronic sequence including the splice acceptor and donor. There is also a 4 bp deletion in the 5-prime intron 16 bp before the exon deletion that will not affect the mutation. This mutation is predicted to result in a change in amino acid sequence after residue 193 and early truncation 15 amino acids later. (J:188991)