Ccdc30^em1(IMPC)J

This allele from project Ccdc30-7437J-M5774 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GATCTGAGAGGATATGCCAA, AGACTACCATTCCGGCTGTG, GCAAGTATGCTCAGGATACG, and CGTGTCAGAGACACGCACAT, which resulted in a 311 bp deletion, spanning ENSMUSE00000449557 (exon 3) beginning at Chromosome 4 negative strand position 119,401,203 bp, GTATCCTGAGCATACTTGCTGT and ending after TCCCCAAGTCTTCAAGAAAT at 119,400,873 bp (GRCm38/mm10), but with 20 bp of intronic sequence, GTGGGGTGATCTGAGAGGAT, retained. This mutation deletes exon 3 and 160 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change of amino acid sequence after residue 55 and early truncation 10 amino acids later. (J:188991)