This allele from project Asb18-7531J-M9871 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTGGGGTACCTGGACCAGT, CCAAGGGCAGACTTGAGTCG, GGGCAAATGGAAGAACCGGT, and CCGTTTGTTGAGGCTGGAGA, which resulted in a 409 bp deletion spanning exon 3 beginning at Chromosome 1 negative strand position 89,993,301 bp, AGCCTCAACAAACGGCTTAC and ending after TTGGAGGTCTTAGGCCTCGAC at 89,992,893 bp (GRCm38/mm10). This mutation deletes exon 3 and 141 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 110 and early truncation 154 amino acids later. (J:188991)