This allele from project Rai14-7533J-F9911 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTTGAAGGCCCCCAAAGCAT, ATACTGGCTTGTTAAGGGTG, AACCGCCTTCCACTTCACCG, and CCATCAGCAAACTCCAACAA, which resulted in a 467 bp deletion spanning exon 3 beginning at Chromosome 15 negative strand position 10,633,455 bp, GTTGGAGTTTGCTGATGGCTG, and ending after ATCAAGGGGAGTTTGACCAAT at 10632989 bp (GRCm38/mm10). This mutation deletes exon 3 and 336 bp of flanking intronic sequence including the splice acceptor and donor. This mutation is predicted to result in a change in amino acid sequence after residue 12 and early truncation 59 amino acids later. (J:188991)