This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGGCGCTGCGAGACGCAGAC, TTTTTATAAATTGACTTACG, GTCAGTCACACCTATCTGAA, and AGTGTGCAGCAGGCTGTGTA, which resulted in a 417 bp deletion beginning at Chromosome 17 negative strand position 10,597,238 bp, TTTTTGATGGGCTTTCTGAA and ending after CAGACTCTAACTTGTCCATTC at 10,596,822 bp (GRCm38/mm10). This mutation deletes 130 bp of ENSMUSE00001269415 (exon 3) and 287 bp of downstream intronic sequence including the splice donor. This mutation is predicted to result in a change of amino acid sequence after residue 95 and early truncation 16 amino acids later. (J:188991)