Thoc6^em5(IMPC)Tcp

This allele, from project TCPR0363, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences GGTCATGTGCAGTCGCTGCA and GCTGCCAGAAACTTCCCGCA. This resulted in a 17 bp deletion from Chr17:23670837 to 23670853 in OTTMUSE00000307828. This mutation is predicted to cause a frameshift with amino acid changes after residue 34 and early truncation 35 amino acids later (p.P34Gfs*37). (GRCm38). (J:165963)