Spx^em1(IMPC)Tcp

This allele produced from project TCPR0399 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences CAGCCTCATCGGACGGAGTG, TTGGTCGATGTGTCTTGTAG, ACTCCTTATTCTCCTCACGG, and GCCGGCTCCAGTAAATAATT. This resulted in a 289 bp deletion from Chr6:142413819 to 142414107 & 31 bp deletion from Chr6:142414151 to 142414181, encompassing ENSMUSE00000608439 & ENSMUSE00000608438. This mutation is predicted to cause a frameshift with amino acid changes after residue 3 and early truncation 27 amino acids later (p.G3Rfs*29). (GRCm38). (J:165963)