This allele, from project TCPR0404, was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences ATGTCCGTTTGGCAGAATAG, ATTAAGATAGAACGCATACC, TTGCACCTCTGGGATAATGT, and GCCTGGGTATGTGATCTATT. This resulted in deletion of 775-bp on Chr12:26327094 to 26327868 deleting exons ENSMUSE00000107366 and ENSMUSE00000107364 (GRCm38). This mutation is predicted to cause a frameshift with amino acid changes after residue 46 and early truncation 21 amino acids later (p.C46Rfs*23). (GRCm38). (J:165963)