This allele produced from project TCPR0244 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence AGAAGATCTCAGATAAATGC and an oligonucleotide repair template encoding a 1-bp insertion. Homology-directed repair resulted in a 1 bp insertion at Chr14:24482833 in ENSMUSE00000514690. This mutation is predicted to cause a frameshift with amino acid changes after residue 149 (p.K149*). A silent change at p.R151 (CGG>CGC) was also introduced which disrupts the PAM sequence. (GRCm38). (J:165963)