Pebp1^em1(IMPC)Tcp

This allele produced from project TCPR0388 at TCP by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TTTTAGTAGCGGCCATACTT, GAATTACCACTAATCTGCAT, GGCTATCTATCATCCGGACA, and ATTCTGCCGTCCTTACAGTA. This resulted in a 811-bp deletion from Chr5:117285622 to 117286432 insCA (GRCm38), exons ENSMUSE00000292490 & ENSMUSE00000292484. This mutation is predicted to cause a frameshift with amino acid changes after residue 47 and early truncation 11 amino acids later (p.M47Sfs*13). (GRCm38). (J:165963)